Control:Article Title: Differentiation of stem cell-derived pancreatic progenitors into insulin-secreting islet clusters in a multiwell-based static 3D culture system
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-PDX1 Abcam Cat# ab47267; RRID: AB_777179 Mouse monoclonal anti-NKX6.1 DSHB Cat# F55A12; RRID: AB_532379 Goat polyclonal anti-NEUROD1 R&D Systems Cat# AF2746; RRID: AB_2149217 Guinea pig polyclonal anti-insulin Abcam Cat# ab195956; RRID: AB_2877638 Mouse monoclonal anti-glucagon Sigma-Aldrich Cat# G2654; RRID: AB_259852 Rabbit polyclonal anti-somatostatin Sigma-Aldrich Cat# HPA019472; RRID: AB_1857360 Goat polyclonal anti-pancreatic polypeptide R&D Systems Cat# AF6297; RRID: AB_10717571 Rabbit polyclonal anti-SLC18A1 Sigma-Aldrich Cat# HPA063797; RRID: AB_2685125 Rabbit polyclonal anti-MAFA Abcam Cat# ab26405; RRID: AB_776146 Rabbit polyclonal anti-GLUT1 Thermo Fisher Scientific Cat# PA1-37782; RRID: AB_2191033 Rabbit polyclonal anti-cleaved caspase 3 Cell Signaling Technology Cat# 9661; RRID: AB_2341188 Alexa Fluor 555 donkey anti-mouse IgG Thermo Fisher Scientific Cat# A31570; RRID: AB_2536180 Alexa Fluor 647 donkey anti-mouse IgG Thermo Fisher Scientific Cat# A31571; RRID: AB_162542 Alexa Fluor 555 donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A31572; RRID: AB_162543 Alexa Fluor 647 donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A31573; RRID: AB_2536183 Alexa Fluor 488 donkey anti-goat IgG Thermo Fisher Scientific Cat# A11055; RRID: AB_2534102 Alexa Fluor 555 donkey anti-goat IgG Thermo Fisher Scientific Cat# A21432; RRID: AB_2535853 Alexa Fluor 647 donkey anti-goat IgG Thermo Fisher Scientific Cat# A21447; RRID: AB_141844 Alexa Fluor 488 donkey anti-guinea pig IgG Jackson Immuno Research Cat# 706-545-148; RRID: AB_2340472 PE mouse anti-PDX1 BD Biosciences Cat# 562161; RRID: AB_10893589 Alexa Fluor 647 mouse anti-NKX6.1 BD Biosciences Cat# 563338; RRID: AB_2738144 PE anti-NKX6.1 BD Biosciences Cat# 563023; RRID: AB_2716792 Alexa Fluor 647 mouse anti-NEUROD1 BD Biosciences Cat# 563566; RRID: AB_2738279 Alexa Fluor 647 mouse anti-insulin BD Biosciences Cat# 565689; RRID: AB_2739331 PE mouse IgG1k, isotype control BD Biosciences Cat# 554680; RRID: AB_395506 (Continued on next page) e1 Cell Reports Methods 3, 100466, May 22, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 647 mouse IgG1k, isotype control BD Biosciences Cat# 557714; RRID: AB_396823 Biological samples Human islets ADI Islet Core https://www.epicore.ualberta.ca/IsletCore/ Chemicals, peptides, and recombinant proteins Matrigel, hESC-qualified Corning Cat# 08-774-552 TrypLE Express Enzyme Thermo Fisher Scientific Cat# 12604021 Accutase STEMCELL Technologies Cat# 07920 Gentle Cell Dissociation Reagent STEMCELL Technologies Cat# 07174 Y-27632 STEMCELL Technologies Cat# 72304 STEMdiffTM Pancreatic Progenitor Kit STEMCELL Technologies Cat# 05120 mTeSR1 Complete Kit STEMCELL Technologies Cat# 85850 DPBS, without Ca2+ and Mg2+ Sigma-Aldrich Cat# D8537 DMEM/F-12, HEPES Thermo Fisher Scientific Cat# 11330-032 MCDB131 medium Life technologies Cat# 10372019 CMRL 1066, Supplemented, CIT modification Corning Cat# 98-304-CV Glutamax Thermo Fisher Scientific Cat# 35050061 ITS-X Thermo Fisher Scientific Cat# 51500056 NaHCO3 Sigma-Aldrich Cat# S6297 D-glucose Sigma-Aldrich Cat# G8769 Fatty acid-free BSA Proliant Cat# 68700 GDF-8 PeproTech Cat# 120-00 MCX-928 Janssen Internal compound N/A CHIR99021 Sigma-Aldrich Cat# SML1046 L-ascorbic acid Sigma-Aldrich Cat# A4544 FGF-7 R&D Systems Cat# 251-KG SANT-1 Sigma-Aldrich Cat# S4572 Retinoid acid, all-trans Sigma-Aldrich Cat# R2625 LDN193189 STEMCELL Technologies Cat# 72147 TPPB Tocris Cat# 5343/1 Triiodothyronine (T3) Sigma-Aldrich Cat# T6397 ALK5 inhibitor II Cayman Chemicals Cat# 14794 Zinc sulfate Sigma-Aldrich Cat# Z0251 Heparin Sigma-Aldrich Cat# H3149 Gamma secretase inhibitor XX (GSi XX) Sigma-Aldrich Cat# 565789 N-acetyl cysteine (NAC) Sigma-Aldrich Cat# A9165 Trolox Sigma-Aldrich Cat# 648471 R428 Cayman Chemicals Cat# 21523 ZM447439 (ZM) SelleckChem Cat# S1103 WNT4 Biorbyt Cat# orb358133 Forskolin (FSK) STEMCELL Technologies Cat# 72114 Critical commercial assays MycoSEQ Mycoplasma Detection Kit Life technologies Cat# 4399363 Fixation/Permeabilization Solution Kit BD Biosciences Cat# 554714 Live/Dead Viability/Cytotoxicity Kit Life technologies Cat# L3224 Human Insulin ELISA Kit ALPCO Cat# 80-INSHU-E01.1 Glucagon ELISA Kit Thermo Fisher Scientific Cat# EHGCG Ultralow Attachment Flat Bottom 96-well plate Corning Costar (VWR) Cat# CLS3474 AggrewellTM 400, 24-well plate STEMCELL Technologies Cat# 34415 (Continued on next page) Cell Reports Methods 3, 100466, May 22, 2023 e2 Report ll OPEN ACCESS
Article Title: Differentiation of stem cell-derived pancreatic progenitors into insulin-secreting islet clusters in a multiwell-based static 3D culture system.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-PDX1 Abcam Cat# ab47267; RRID: AB_777179 Mouse monoclonal anti-NKX6.1 DSHB Cat# F55A12; RRID: AB_532379 Goat polyclonal anti-NEUROD1 R&D Systems Cat# AF2746; RRID: AB_2149217 Guinea pig polyclonal anti-insulin Abcam Cat# ab195956; RRID: AB_2877638 Mouse monoclonal anti-glucagon Sigma-Aldrich Cat# G2654; RRID: AB_259852 Rabbit polyclonal anti-somatostatin Sigma-Aldrich Cat# HPA019472; RRID: AB_1857360 Goat polyclonal anti-pancreatic polypeptide R&D Systems Cat# AF6297; RRID: AB_10717571 Rabbit polyclonal anti-SLC18A1 Sigma-Aldrich Cat# HPA063797; RRID: AB_2685125 Rabbit polyclonal anti-MAFA Abcam Cat# ab26405; RRID: AB_776146 Rabbit polyclonal anti-GLUT1 Thermo Fisher Scientific Cat# PA1-37782; RRID: AB_2191033 Rabbit polyclonal anti-cleaved caspase 3 Cell Signaling Technology Cat# 9661; RRID: AB_2341188 Alexa Fluor 555 donkey anti-mouse IgG Thermo Fisher Scientific Cat# A31570; RRID: AB_2536180 Alexa Fluor 647 donkey anti-mouse IgG Thermo Fisher Scientific Cat# A31571; RRID: AB_162542 Alexa Fluor 555 donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A31572; RRID: AB_162543 Alexa Fluor 647 donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A31573; RRID: AB_2536183 Alexa Fluor 488 donkey anti-goat IgG Thermo Fisher Scientific Cat# A11055; RRID: AB_2534102 Alexa Fluor 555 donkey anti-goat IgG Thermo Fisher Scientific Cat# A21432; RRID: AB_2535853 Alexa Fluor 647 donkey anti-goat IgG Thermo Fisher Scientific Cat# A21447; RRID: AB_141844 Alexa Fluor 488 donkey anti-guinea pig IgG Jackson Immuno Research Cat# 706-545-148; RRID: AB_2340472 PE mouse anti-PDX1 BD Biosciences Cat# 562161; RRID: AB_10893589 Alexa Fluor 647 mouse anti-NKX6.1 BD Biosciences Cat# 563338; RRID: AB_2738144 PE anti-NKX6.1 BD Biosciences Cat# 563023; RRID: AB_2716792 Alexa Fluor 647 mouse anti-NEUROD1 BD Biosciences Cat# 563566; RRID: AB_2738279 Alexa Fluor 647 mouse anti-insulin BD Biosciences Cat# 565689; RRID: AB_2739331 PE mouse IgG1k, isotype control BD Biosciences Cat# 554680; RRID: AB_395506 (Continued on next page) e1 Cell Reports Methods 3, 100466, May 22, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Alexa Fluor 647 mouse IgG1k, isotype control BD Biosciences Cat# 557714; RRID: AB_396823 Biological samples Human islets ADI Islet Core https://www.epicore.ualberta.ca/IsletCore/ Chemicals, peptides, and recombinant proteins Matrigel, hESC-qualified Corning Cat# 08-774-552 TrypLE Express Enzyme Thermo Fisher Scientific Cat# 12604021 Accutase STEMCELL Technologies Cat# 07920 Gentle Cell Dissociation Reagent STEMCELL Technologies Cat# 07174 Y-27632 STEMCELL Technologies Cat# 72304 STEMdiffTM Pancreatic Progenitor Kit STEMCELL Technologies Cat# 05120 mTeSR1 Complete Kit STEMCELL Technologies Cat# 85850 DPBS, without Ca2+ and Mg2+ Sigma-Aldrich Cat# D8537 DMEM/F-12, HEPES Thermo Fisher Scientific Cat# 11330-032 MCDB131 medium Life technologies Cat# 10372019 CMRL 1066, Supplemented, CIT modification Corning Cat# 98-304-CV Glutamax Thermo Fisher Scientific Cat# 35050061 ITS-X Thermo Fisher Scientific Cat# 51500056 NaHCO3 Sigma-Aldrich Cat# S6297 D-glucose Sigma-Aldrich Cat# G8769 Fatty acid-free BSA Proliant Cat# 68700 GDF-8 PeproTech Cat# 120-00 MCX-928 Janssen Internal compound N/A CHIR99021 Sigma-Aldrich Cat# SML1046 L-ascorbic acid Sigma-Aldrich Cat# A4544 FGF-7 R&D Systems Cat# 251-KG SANT-1 Sigma-Aldrich Cat# S4572 Retinoid acid, all-trans Sigma-Aldrich Cat# R2625 LDN193189 STEMCELL Technologies Cat# 72147 TPPB Tocris Cat# 5343/1 Triiodothyronine (T3) Sigma-Aldrich Cat# T6397 ALK5 inhibitor II Cayman Chemicals Cat# 14794 Zinc sulfate Sigma-Aldrich Cat# Z0251 Heparin Sigma-Aldrich Cat# H3149 Gamma secretase inhibitor XX (GSi XX) Sigma-Aldrich Cat# 565789 N-acetyl cysteine (NAC) Sigma-Aldrich Cat# A9165 Trolox Sigma-Aldrich Cat# 648471 R428 Cayman Chemicals Cat# 21523 ZM447439 (ZM) SelleckChem Cat# S1103 WNT4 Biorbyt Cat# orb358133 Forskolin (FSK) STEMCELL Technologies Cat# 72114 Critical commercial assays MycoSEQ Mycoplasma Detection Kit Life technologies Cat# 4399363 Fixation/Permeabilization Solution Kit BD Biosciences Cat# 554714 Live/Dead Viability/Cytotoxicity Kit Life technologies Cat# L3224 Human Insulin ELISA Kit ALPCO Cat# 80-INSHU-E01.1 Glucagon ELISA Kit Thermo Fisher Scientific Cat# EHGCG Ultralow Attachment Flat Bottom 96-well plate Corning Costar (VWR) Cat# CLS3474 AggrewellTM 400, 24-well plate STEMCELL Technologies Cat# 34415 (Continued on next page) Cell Reports Methods 3, 100466, May 22, 2023 e2
FACS:Article Title: Hypothyroidism Impairs Human Stem Cell-Derived Pancreatic Progenitor Cell Maturation in Mice.
Article Snippet: GENE NAME PRIMER REFERENCE / SEQUENCE ABCC8 Hs00165861_m1 ARX Hs00292465_m1 CHGA Hs00154441_m1 GCG Hs00174967_m1 GHRL Hs00175082_m1 G6PC2 Hs01549773_m1 IAPP Hs00169095_m1 INS Hs00355773_m1 ISL1 Hs00158126_m1 MAFA Hs01651425_s1 NGN3 Hs00360700_g1 MNX1 Hs00232128_m1 NKX2.2 Hs00159616_m1 NKX6.1 Hs00232355_m1 PAX6 Hs00240871_m1 PCSK1 Hs00175619_m1 PCSK2 Hs01037347_m1 PDX1 Hs00236830_m1 SLC30A8 Hs00545183_m1 SST Hs00356144_m1 UCN3 Hs00846499_s1 Page 41 of 48 Diabetes Supplementary Table 3: Antibody information for immunofluorescent staining. .. ANTIGEN SPECIES SOURCE, CATALOGUE NUMBER DILUTION Amylin Rabbit Abcam, Ab15125 1:50 CK19 Mouse Dako, Denmark, M 0888 1:200 Glucagon Mouse Sigma-Aldrich, G 2654 1:1000 Glucagon (D16G10) Rabbit Cell Signaling Technology, 8233S 1:500 Insulin (C27C9) Rabbit Cell Signaling Technology, 3014S 1:200 Insulin (Mab1) Mouse Millipore, 05-1108 1:200 Insulin (L6B10) Mouse mAb Mouse Cell Signaling Technology, 8138S 1:250 Insulin Guinea Pig Thermo Scientific, PA1-26938 1:100 MAFA Rabbit Betalogics (Janssen R&D), LP9872 1:1000 NKX2.2 Mouse Developmental Studies Hybridoma Bank; University of Iowa, 74.5A5 1:100 Somatostatin Mouse Beta Cell Biology Consortium, AB1985 1:500 Somatostatin Rabbit Sigma-Aldrich, HPA019472 1:500 Synaptophysin Rabbit Novus Biologicals, NB120-16659 1:50 Trypsin Sheep R&D Systems, AF3586 1:100 Ghrelin Rabbit BioVision, 5991-100 1:200 Ghrelin Chicken Abcam, ab15861 1:50 Pancreatic polypeptide Goat R&D Systems, AF6297 1:200 Proliferating cell nuclear antigen (PCNA) Mouse BD Biosciences, 610665 1:100 Page 42 of 48Diabetes Supplementary Figure 1: FACS characterization of hESC-derived pancreatic progenitor cells. ..
Article Title: Accelerated Maturation of Human Stem Cell-Derived Pancreatic Progenitor Cells into Insulin-Secreting Cells in Immunodeficient Rats Relative to Mice
Article Snippet: The array strip was then washed and stained as directed by the kit, using the GeneAtlas Fluidics Station (Affymetrix). .. ANTIGEN SPECIES SOURCE DILUTION CK19 Mouse Dako, Denmark, M 0888 1:100 Glucagon Mouse Sigma-Aldrich, G 2654 1:1000 Glucagon(D16G10) Rabbit Cell Signaling Technology, 8233P 1:500 Insulin Guinea Pig Sigma-Aldrich, I8510 1:1000 Insulin(C27C9) Rabbit Cell Signaling Technology, 3014 1:200 Insulin Mouse Millipore, 05-1108 1:200 MAFA Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX6.1 Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX2.2 Mouse Developmental Studies Hybridoma Bank; University of Iowa, 74.5A5 1:100 PDX1 Guinea Pig Abcam, ab47308 1:1000 Somatostatin Mouse Beta Cell Biology Consortium, AB1985 1:500 Synaptophysin Rabbit Novus Biologicals, NB120-16659 1:50 Trypsin Sheep R&D Systems, AF3586 1:100 Proinsulin (GS9A8) Mouse Beta Cell Biology Consortium, GS9A8 1:250 PC1/3 Rabbit Gift from Dr. Lakshmi Devi 1:500 Ghrelin Rabbit BioVision, 5991-100 1:200 Pancreatic polypeptide Goat R&D Systems, AF6297 1:200 SerpinB2 Rabbit Novus Biologicals, NBP1-83163 1:100 DGCR2 Rabbit Novus Biologicals, NBP1-84255 1:25 ARX Rabbit Gift from Dr. Collombat 1:500 Table S5: List of qPCR primers, related to Figure 2 and S7. qPCR SYSTEM GENE NAME (species) PRIMER REFERENCE / SEQUENCE Applied Biosystems PCR array GAPDH Hs99999905_m1 ABCC8 Hs00165861_m1 ARX Hs00292465_m1 GCG Hs00174967_m1 GHRL Hs00175082_m1 IAPP Hs00169095_m1 INS Hs00355773_m1 MAFA Hs01651425_s1 MAFB Hs00534343_s1 NEUROD1 Hs00159598_m1 NEUROG3 Hs00360700_g1 NKX2.2 Hs00159616_m1 NKX6.1 Hs00232355_m1 PAX4 Hs00173014_m1 PAX6 Hs00240871_m1 PCSK1 Hs00175619_m1 PDX1 Hs00236830_m1 PPY1 Hs00237001_m1 PTF1A Hs00603586_g1 SST Hs00356144_m1 StepOne Real-Time PCR MT1F-F (human) CCACTGCTTCTTCGCTTCTCTCTT MT1F-R (human) TCTTCTTGCAGGAGGTGCATTTG MT1X-F (human) CGCTGCGTGTTTTCCTCTTGAT MT1X-R (human) TCTTCTTGCAGGAGGTGCATTTG (common to both MT1F and MT1X) Mt1-F (rat) CTGAAGTGACGAACAGTGCTG Mt1-R (rat) CAGGCTTTTATTATTCACATGCTCG GAPDH-F (human) TGCACCACCAACTGCTTAGC GAPDH-R (human) GGCATGGACTGTGGTCATGAG Gapdh-F (rat) GATGGTGAAGGTCGGTGTGA Gapdh-R (rat) CTCCTGGAAGATGGTGATGGG Figure S1: FACS characterization of hESC-derived pancreatic progenitor cells (related to all main figures). ..
other:Article Title: Accelerated Maturation of Human Stem Cell-Derived Pancreatic Progenitor Cells into Insulin-Secreting Cells in Immunodeficient Rats Relative to Mice
Article Snippet: ANTIGEN CONJUGATED FLUOROPHORE SPECIES SOURCE (Catalogue #) DILUTION Chromogranin A None Rabbit Dako (# IS502) 1:10 Ki67 Alexa Fluor 647 Mouse BD (# 561126) 1:20 NKX2.2 None Mouse Developmental Studies Hybridoma Bank University of Iowa 1:100 NKX6.1 None Mouse Developmental Studies Hybridoma Bank University of Iowa 1:50 PAX6 PE Mouse BD (# 561552) 1:20 PDX1 PE Mouse BD (# 562161) 1:20 OCT3/4 AF647 Mouse BD (# 560329) 1:20 Synaptophysin None Rabbit Abcam (# ab52636) 1:40 IgG1, k, Isotype Control PE Mouse BD (# 555749) 1:40 IgG1, k, Isotype control Alexa Fluor 647 Mouse BD (# 557732) 1:40 Purified IgG, k Isotype None Rabbit BD (# 550875) 1:1000 Purified IgG, k Isotype None Mouse BD (# 557273) 1:50 Table S4: Antibody information for immunofluorescent staining, related to Figures 3-6 and S5S7.
Real-time Polymerase Chain Reaction:Article Title: Accelerated Maturation of Human Stem Cell-Derived Pancreatic Progenitor Cells into Insulin-Secreting Cells in Immunodeficient Rats Relative to Mice
Article Snippet: The array strip was then washed and stained as directed by the kit, using the GeneAtlas Fluidics Station (Affymetrix). .. ANTIGEN SPECIES SOURCE DILUTION CK19 Mouse Dako, Denmark, M 0888 1:100 Glucagon Mouse Sigma-Aldrich, G 2654 1:1000 Glucagon(D16G10) Rabbit Cell Signaling Technology, 8233P 1:500 Insulin Guinea Pig Sigma-Aldrich, I8510 1:1000 Insulin(C27C9) Rabbit Cell Signaling Technology, 3014 1:200 Insulin Mouse Millipore, 05-1108 1:200 MAFA Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX6.1 Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX2.2 Mouse Developmental Studies Hybridoma Bank; University of Iowa, 74.5A5 1:100 PDX1 Guinea Pig Abcam, ab47308 1:1000 Somatostatin Mouse Beta Cell Biology Consortium, AB1985 1:500 Synaptophysin Rabbit Novus Biologicals, NB120-16659 1:50 Trypsin Sheep R&D Systems, AF3586 1:100 Proinsulin (GS9A8) Mouse Beta Cell Biology Consortium, GS9A8 1:250 PC1/3 Rabbit Gift from Dr. Lakshmi Devi 1:500 Ghrelin Rabbit BioVision, 5991-100 1:200 Pancreatic polypeptide Goat R&D Systems, AF6297 1:200 SerpinB2 Rabbit Novus Biologicals, NBP1-83163 1:100 DGCR2 Rabbit Novus Biologicals, NBP1-84255 1:25 ARX Rabbit Gift from Dr. Collombat 1:500 Table S5: List of qPCR primers, related to Figure 2 and S7. qPCR SYSTEM GENE NAME (species) PRIMER REFERENCE / SEQUENCE Applied Biosystems PCR array GAPDH Hs99999905_m1 ABCC8 Hs00165861_m1 ARX Hs00292465_m1 GCG Hs00174967_m1 GHRL Hs00175082_m1 IAPP Hs00169095_m1 INS Hs00355773_m1 MAFA Hs01651425_s1 MAFB Hs00534343_s1 NEUROD1 Hs00159598_m1 NEUROG3 Hs00360700_g1 NKX2.2 Hs00159616_m1 NKX6.1 Hs00232355_m1 PAX4 Hs00173014_m1 PAX6 Hs00240871_m1 PCSK1 Hs00175619_m1 PDX1 Hs00236830_m1 PPY1 Hs00237001_m1 PTF1A Hs00603586_g1 SST Hs00356144_m1 StepOne Real-Time PCR MT1F-F (human) CCACTGCTTCTTCGCTTCTCTCTT MT1F-R (human) TCTTCTTGCAGGAGGTGCATTTG MT1X-F (human) CGCTGCGTGTTTTCCTCTTGAT MT1X-R (human) TCTTCTTGCAGGAGGTGCATTTG (common to both MT1F and MT1X) Mt1-F (rat) CTGAAGTGACGAACAGTGCTG Mt1-R (rat) CAGGCTTTTATTATTCACATGCTCG GAPDH-F (human) TGCACCACCAACTGCTTAGC GAPDH-R (human) GGCATGGACTGTGGTCATGAG Gapdh-F (rat) GATGGTGAAGGTCGGTGTGA Gapdh-R (rat) CTCCTGGAAGATGGTGATGGG Figure S1: FACS characterization of hESC-derived pancreatic progenitor cells (related to all main figures). ..
Sequencing:Article Title: Accelerated Maturation of Human Stem Cell-Derived Pancreatic Progenitor Cells into Insulin-Secreting Cells in Immunodeficient Rats Relative to Mice
Article Snippet: The array strip was then washed and stained as directed by the kit, using the GeneAtlas Fluidics Station (Affymetrix). .. ANTIGEN SPECIES SOURCE DILUTION CK19 Mouse Dako, Denmark, M 0888 1:100 Glucagon Mouse Sigma-Aldrich, G 2654 1:1000 Glucagon(D16G10) Rabbit Cell Signaling Technology, 8233P 1:500 Insulin Guinea Pig Sigma-Aldrich, I8510 1:1000 Insulin(C27C9) Rabbit Cell Signaling Technology, 3014 1:200 Insulin Mouse Millipore, 05-1108 1:200 MAFA Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX6.1 Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX2.2 Mouse Developmental Studies Hybridoma Bank; University of Iowa, 74.5A5 1:100 PDX1 Guinea Pig Abcam, ab47308 1:1000 Somatostatin Mouse Beta Cell Biology Consortium, AB1985 1:500 Synaptophysin Rabbit Novus Biologicals, NB120-16659 1:50 Trypsin Sheep R&D Systems, AF3586 1:100 Proinsulin (GS9A8) Mouse Beta Cell Biology Consortium, GS9A8 1:250 PC1/3 Rabbit Gift from Dr. Lakshmi Devi 1:500 Ghrelin Rabbit BioVision, 5991-100 1:200 Pancreatic polypeptide Goat R&D Systems, AF6297 1:200 SerpinB2 Rabbit Novus Biologicals, NBP1-83163 1:100 DGCR2 Rabbit Novus Biologicals, NBP1-84255 1:25 ARX Rabbit Gift from Dr. Collombat 1:500 Table S5: List of qPCR primers, related to Figure 2 and S7. qPCR SYSTEM GENE NAME (species) PRIMER REFERENCE / SEQUENCE Applied Biosystems PCR array GAPDH Hs99999905_m1 ABCC8 Hs00165861_m1 ARX Hs00292465_m1 GCG Hs00174967_m1 GHRL Hs00175082_m1 IAPP Hs00169095_m1 INS Hs00355773_m1 MAFA Hs01651425_s1 MAFB Hs00534343_s1 NEUROD1 Hs00159598_m1 NEUROG3 Hs00360700_g1 NKX2.2 Hs00159616_m1 NKX6.1 Hs00232355_m1 PAX4 Hs00173014_m1 PAX6 Hs00240871_m1 PCSK1 Hs00175619_m1 PDX1 Hs00236830_m1 PPY1 Hs00237001_m1 PTF1A Hs00603586_g1 SST Hs00356144_m1 StepOne Real-Time PCR MT1F-F (human) CCACTGCTTCTTCGCTTCTCTCTT MT1F-R (human) TCTTCTTGCAGGAGGTGCATTTG MT1X-F (human) CGCTGCGTGTTTTCCTCTTGAT MT1X-R (human) TCTTCTTGCAGGAGGTGCATTTG (common to both MT1F and MT1X) Mt1-F (rat) CTGAAGTGACGAACAGTGCTG Mt1-R (rat) CAGGCTTTTATTATTCACATGCTCG GAPDH-F (human) TGCACCACCAACTGCTTAGC GAPDH-R (human) GGCATGGACTGTGGTCATGAG Gapdh-F (rat) GATGGTGAAGGTCGGTGTGA Gapdh-R (rat) CTCCTGGAAGATGGTGATGGG Figure S1: FACS characterization of hESC-derived pancreatic progenitor cells (related to all main figures). ..
Polymerase Chain Reaction:Article Title: Accelerated Maturation of Human Stem Cell-Derived Pancreatic Progenitor Cells into Insulin-Secreting Cells in Immunodeficient Rats Relative to Mice
Article Snippet: The array strip was then washed and stained as directed by the kit, using the GeneAtlas Fluidics Station (Affymetrix). .. ANTIGEN SPECIES SOURCE DILUTION CK19 Mouse Dako, Denmark, M 0888 1:100 Glucagon Mouse Sigma-Aldrich, G 2654 1:1000 Glucagon(D16G10) Rabbit Cell Signaling Technology, 8233P 1:500 Insulin Guinea Pig Sigma-Aldrich, I8510 1:1000 Insulin(C27C9) Rabbit Cell Signaling Technology, 3014 1:200 Insulin Mouse Millipore, 05-1108 1:200 MAFA Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX6.1 Rabbit Custom Ab, Lifespan Biosciences 1:1000 NKX2.2 Mouse Developmental Studies Hybridoma Bank; University of Iowa, 74.5A5 1:100 PDX1 Guinea Pig Abcam, ab47308 1:1000 Somatostatin Mouse Beta Cell Biology Consortium, AB1985 1:500 Synaptophysin Rabbit Novus Biologicals, NB120-16659 1:50 Trypsin Sheep R&D Systems, AF3586 1:100 Proinsulin (GS9A8) Mouse Beta Cell Biology Consortium, GS9A8 1:250 PC1/3 Rabbit Gift from Dr. Lakshmi Devi 1:500 Ghrelin Rabbit BioVision, 5991-100 1:200 Pancreatic polypeptide Goat R&D Systems, AF6297 1:200 SerpinB2 Rabbit Novus Biologicals, NBP1-83163 1:100 DGCR2 Rabbit Novus Biologicals, NBP1-84255 1:25 ARX Rabbit Gift from Dr. Collombat 1:500 Table S5: List of qPCR primers, related to Figure 2 and S7. qPCR SYSTEM GENE NAME (species) PRIMER REFERENCE / SEQUENCE Applied Biosystems PCR array GAPDH Hs99999905_m1 ABCC8 Hs00165861_m1 ARX Hs00292465_m1 GCG Hs00174967_m1 GHRL Hs00175082_m1 IAPP Hs00169095_m1 INS Hs00355773_m1 MAFA Hs01651425_s1 MAFB Hs00534343_s1 NEUROD1 Hs00159598_m1 NEUROG3 Hs00360700_g1 NKX2.2 Hs00159616_m1 NKX6.1 Hs00232355_m1 PAX4 Hs00173014_m1 PAX6 Hs00240871_m1 PCSK1 Hs00175619_m1 PDX1 Hs00236830_m1 PPY1 Hs00237001_m1 PTF1A Hs00603586_g1 SST Hs00356144_m1 StepOne Real-Time PCR MT1F-F (human) CCACTGCTTCTTCGCTTCTCTCTT MT1F-R (human) TCTTCTTGCAGGAGGTGCATTTG MT1X-F (human) CGCTGCGTGTTTTCCTCTTGAT MT1X-R (human) TCTTCTTGCAGGAGGTGCATTTG (common to both MT1F and MT1X) Mt1-F (rat) CTGAAGTGACGAACAGTGCTG Mt1-R (rat) CAGGCTTTTATTATTCACATGCTCG GAPDH-F (human) TGCACCACCAACTGCTTAGC GAPDH-R (human) GGCATGGACTGTGGTCATGAG Gapdh-F (rat) GATGGTGAAGGTCGGTGTGA Gapdh-R (rat) CTCCTGGAAGATGGTGATGGG Figure S1: FACS characterization of hESC-derived pancreatic progenitor cells (related to all main figures). ..
|
R&D Systems is a verified supplier 
R&D Systems manufactures this product 
